readFastq {ShortRead} | R Documentation |
readFastq
reads all FASTQ-formated files in a directory
dirPath
whose file name matches pattern pattern
,
returning a compact internal representation of the sequences and
quality scores in the files. Methods read all files into a single R
object; a typical use is to restrict input to a single FASTQ file.
readFastq(dirPath, pattern=character(0), ...)
dirPath |
A character vector (or other object; see methods defined on this generic) giving the directory path (relative or absolute) of FASTQ files to be read. |
pattern |
The (grep -style) pattern describing file
names to be read. The default (character(0) ) results in line
(attempted) input of all files in the directory. |
... |
Additional arguments, perhaps used by methods. |
The fastq format is not quite precisely defined. The basic definition used here parses the following four lines as a single record:
@HWI-EAS88_1_1_1_1001_499 GGACTTTGTAGGATACCCTCGCTTTCCTTCTCCTGT +HWI-EAS88_1_1_1_1001_499 ]]]]]]]]]]]]Y]Y]]]]]]]]]]]]VCHVMPLAS
The first and third lines are identifiers preceded by a specific
character (the identifiers are identical, in the case of Solexa). The
second line is an upper-case sequence of nucleotides. The parser
recognizes IUPAC-standard alphabet (hence ambiguous nucleotides),
coercing .
to -
to represent missing values. The final
line is an ASCII-encoded representation of quality scores, with one
ASCII character per nucleotide.
The encoding implicit in Solexa-derived fastq files is that each
character code corresponds to a score equal to the ASCII character
value minus 64 (e.g., ASCII @
is decimal 64, and corresponds to
a Solexa quality score of 0). This is different from BioPerl, for
instance, which recovers quality scores by subtracting 33 from the
ASCII character value (so that, for instance, !
, with decimal
value 33, encodes value 0).
The BioPerl description of fastq asserts that the first character of
line 4 is a !
, but the current parser does not support this
convention.
A single R object (e.g., ShortReadQ
) containing
sequences and qualities contained in all files in dirPath
matching pattern
. There is no guarantee of order in which files
are read.
Martin Morgan
The IUPAC alphabet in Biostrings.
http://www.bioperl.org/wiki/FASTQ_sequence_format for the BioPerl definition of fastq.
Solexa documentation `Data analysis - documentation : Pipeline output and visualisation'.
showMethods("readFastq") sp <- SolexaPath(system.file('extdata', package='ShortRead')) rfq <- readFastq(analysisPath(sp), pattern="s_1_sequence.txt") sread(rfq) id(rfq) quality(rfq) ## SolexaPath method 'knows' where FASTQ files are placed rfq1 <- readFastq(sp, pattern="s_1_sequence.txt") rfq1